rs12448307 chr16:10297813 G>T
- Sequence
acctccgctagttcagagaaaggc[G/T]cccacagtgactgggtgaccaaga
- ASB for transcription factors
- ZN687_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN687_HUMAN | 2.27 | -1.94 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, cystatin c in serum, infant head circumference, ldl cholesterol change with statins, refractive error, serum creatinine, total cholesterol change with statins