rs12453584 chr17:70271592 G>A
- Sequence
cccataaatgggtctttatgaaga[G/A]aaaacagactcctatgttaagaca
- ASB in cell types
- breast tumor
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 3.03 | -5.36 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, coronary artery disease (cad), ldl cholesterol, thyrotoxic hypokalemic periodic paralysis in male patients with graves disease