rs12463142 chr19:35315986 C>A
- Sequence
tttttacagcaggggtccccagtg[C/A]tatactgcacacccagatactggt
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | 2.12 | -1.54 | 1.00 | |||
| K562 (myelogenous leukemia) | 0.11 | 0.82 | 1.99 |
Items per page:
1 – 2 of 2