rs12470189 chr2:119291056 G>A
- Sequence
tcccaggcccagacagactctgct[G/A]ccacctggtggctgaagggtaggc
- ASB in cell types
- A549 (lung carcinoma) 2588 (Lymphoblastoid Cell Lines) GM18505 (female B-cells Lymphoblastoid Cell Lines) neural cell
- ASB for transcription factors
- CTCF_HUMAN RAD21_HUMAN SMC3_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.40 | 0.56 | 1.65 | -5.57 | Concordant | |||
| RAD21_HUMAN | 1.34 | 0.23 | 1.83 | n/a | n/a | |||
| SMC3_HUMAN | 1.63 | 0.04 | 2.00 | n/a | n/a | |||
| STAG1_HUMAN | 2.46 | 3.96 | 2.25 | n/a | n/a | |||
| SMC1A_HUMAN | 2.39 | -0.12 | 1.67 | n/a | n/a |
Items per page:
1 – 5 of 7
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Whole_Blood