rs12476111 chr2:106542858 G>A
- Sequence
catgtgcgcccatcatccagcccc[G/A]gcttatcaactgagcagtgcccct
- ASB in cell types
- neutrophils from periferal blood erythroid cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | 3.02 | -0.22 | 2.00 | |||
| erythroid cells | 1.79 | -4.46 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg