rs12495924 chr3:171865530 C>G
- Sequence
gtgactttgaaatgaaacttcatt[C/G]catttgagtagattagcatcaagg
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 1.75 | -1.08 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, hdl cholesterol change with statins, ldl cholesterol change with statins, major depressive disorder, maternal transmission distortion, refractive error, total cholesterol change with statins, transmission distortion