rs12499903 chr4:155597555 G>A
- Sequence
agttgttattttagaagaaaaaac[G/A]agaccagtatccaaaattttagtc
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 2.77 | -5.29 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, age at death with kuru exposure, aortic valve calcium, diastolic blood pressure (dbp), hdl cholesterol, systolic blood pressure (sbp)