rs12508086 chr4:102405992 T>C
- Sequence
gcatgcctgggccagactaatata[T/C]ggtaacagcccacagtgacagcta
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa S3 (cervical adenocarcinoma) | -0.86 | 1.85 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood