rs12508743 chr4:3480739 A>G
- Sequence
gcagcctgcgggggcagcctggac[A/G]gagctggctggaaccctggcctct
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) foreskin keratinocyte epidermal keratinocytes A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.22 | 1.11 | 1.96 | |||
| foreskin keratinocyte | 0.43 | n/a | 2.67 | |||
| epidermal keratinocytes | 2.49 | 0.06 | 2.00 | |||
| A549 (lung carcinoma) | 0.77 | 0.59 | 1.05 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | -1.24 | 1.24 | 1.00 |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood