rs12523418 chr5:142327660 A>G
- Sequence
ggatggtggaaggagctgattctg[A/G]tttggtcatcagggaatgtctctg
- ASB in cell types
- K562 (myelogenous leukemia) epithelial cell of prostate
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.57 | -1.52 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, age at death with kuru exposure, hypertension (early onset hypertension), paternal transmission distortion, sporadic creutzfeldt-jakob disease, testicular germ cell tumor (testicular cancer), transmission distortion, triglycerides, years of education