rs12529 chr10:5094459 C>G
- Sequence
gtgacagggaatggattccaaaca[C/G]cagtgtgtaaagctaaatgatggc
- ASB in cell types
- HepG2 (hepatoblastoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.01 | 1.03 | 1.15 | |||
| K562 (myelogenous leukemia) | -0.19 | 1.03 | 2.06 |
Items per page:
1 – 2 of 2