rs12536766 chr7:70693878 G>T
- Sequence
cggggggagccgagggctcgagcc[G/T]cggggggagcaacagctgtcgatg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) GBM39 (Human brain tumor) Peyer's patch
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 1.22 | 0.67 | 1.07 | |||
| GBM39 (Human brain tumor) | 1.35 | 0.07 | 2.00 | |||
| Peyer's patch | -1.75 | 2.14 | 1.00 |
Items per page:
1 – 3 of 3