rs12541975 chr8:684921 G>C
- Sequence
aatatcacaaggcaaatgagcagg[G/C]caaggtcacaaggccagggcgaaa
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MDA-MB-134 (invasive lobular breast carcinoma)
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.29 | -1.01 | 1.90 | -1.08 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
