rs12568320 chr1:157774214 A>G
- Sequence
tggaagactgcattgaggcaatgg[A/G]tggggacagaaagaccttttcagc
- ASB in cell types
- H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | 0.00 | 1.82 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease (apoe4 positive), body mass index (bmi), cognitive response to topiramate treatment as measured by the controlled oral word association cognitive test, hdl cholesterol, longstanding arthritis, obesity with early age of onset (age >2), total cholesterol
GTEx eQTL Adipose_Subcutaneous, Colon_Transverse, Esophagus_Mucosa, Lung, Minor_Salivary_Gland, Whole_Blood