rs12585587 chr13:27450557 G>A
- Sequence
tactgtagcggacgcaagtacagc[G/A]gatctgcggcgagtccccttcgct
- ASB in cell types
- Peyer's patch HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Peyer's patch | 2.27 | n/a | 1.00 | |||
| HepG2 (hepatoblastoma) | 0.75 | 0.38 | 1.17 |
Items per page:
1 – 2 of 2