rs126013 chr1:28893758 A>C
- Sequence
tgtgctgtgtgtctcactgctgtc[A/C]tttgcttccatgtgccactgcggt
- ASB in cell types
- K562 (myelogenous leukemia) GM18505 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.67 | 0.64 | 1.04 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 2.11 | 0.02 | 1.00 |
Items per page:
1 – 2 of 2