rs12603053 chr17:43550924 T>C
- Sequence
ttcagcctgctagctgggagtata[T/C]tgggctaaagaggaagcgcacaga
- ASB in cell types
- MDM(monocyte derived macrophages) THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | 2.85 | -0.69 | 2.00 | |||
| THP-1 (acute monocytic leukemia) | -0.33 | 1.46 | 1.35 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Lung, Nerve_Tibial, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid