rs12610821 chr19:719295 C>G
- Sequence
tgggcccttccaacaccaacgccc[C/G]gcaccgcggaggcctctgcggggc
- ASB in cell types
- HepG2 (hepatoblastoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.30 | 0.79 | 1.12 | |||
| K562 (myelogenous leukemia) | -0.05 | 1.01 | 2.12 |
Items per page:
1 – 2 of 2