rs12628806 chr22:25764403 T>A
- Sequence
aggtagaaagggcatctctttgtg[T/A]ctccagcgcccccttcagacaagg
- ASB in cell types
- EOL-1 (Acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| EOL-1 (Acute myeloid leukemia) | -2.13 | 2.27 | 1.00 |
Items per page:
1 – 1 of 1