rs12656 chr12:54286558 A>T
- Sequence
tggctcaaagtaatagacttcccc[A/T]aatggtggggggatgggtgggtta
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.21 | 0.73 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Brain_Hippocampus, Esophagus_Mucosa, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg