rs12658751 chr5:174793779 C>T
- Sequence
gaaaccctccgcagtcccctaccc[C/T]agaaaggtttcccttccctcccct
- ASB in cell types
- RWPE1 (prostate epithelial cells) esophagus muscularis mucosa
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RWPE1 (prostate epithelial cells) | n/a | 1.88 | 2.00 | |||
| esophagus muscularis mucosa | 2.24 | -2.06 | 1.00 |
Items per page:
1 – 2 of 2