rs12671921 chr7:54788835 G>A
- Sequence
aagtaggatcccacccagatctgc[G/A]ttctccacctgctgtcacatgatg
- ASB in cell types
- glioblastoma cells GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | n/a | 2.31 | 2.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | -0.92 | 1.16 | 1.00 |
Items per page:
1 – 2 of 2