rs12682501 chr8:120868913 G>A
- Sequence
ggaactgaggtacagaaatcggaa[G/A]tgaggtacagaaatagctttattg
- ASB in cell types
- RWPE1 (prostate epithelial cells) GM12891 (male B- cells lymphoblastoid cell line) HepG2 (hepatoblastoma) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- SPI1_HUMAN CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.82 | -0.26 | 2.08 | -3.23 | Concordant | |||
| CREB1_HUMAN | 1.64 | -0.33 | 1.38 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
