rs12694164 chr2:209208411 A>C
- Sequence
aagcatacaacattccttatcaca[A/C]actaaacttccttttcactcaccc
- ASB in cell types
- MS-1 (Small cell lung carcinoma) HMEC (human mammary epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | 0.82 | -0.36 | 1.00 | |||
| HMEC (human mammary epithelial cells) | -2.66 | 2.57 | 1.00 |
Items per page:
1 – 2 of 2