rs12698333 chr7:155885815 G>C
- Sequence
ctctcggcacacgctgggctattc[G/C]atgattagacttgtgtttctcttt
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.25 | 0.52 | 2.12 |
Items per page:
1 – 1 of 1