rs12719270 chr5:120037763 T>G
- Sequence
tctgagaaatttaaatctattcat[T/G]aattactatttctttccaaagtgc
- ASB in cell types
- MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | n/a | 1.83 | 2.25 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adrenal_Gland, Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Muscularis, Heart_Atrial_Appendage