rs12725704 chr1:10553294 T>C
- Sequence
gggctcactgtccaaatttttggc[T/C]tagggagctggtgtggaggatagc
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- OSR2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| OSR2_HUMAN | 2.90 | n/a | 2.00 | -0.29 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP college completion, ldl cholesterol, microalbuminuria, systolic blood pressure (sbp), total cholesterol, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Pancreas, Stomach, Testis, Thyroid, Whole_Blood