rs12727817 chr1:163528721 T>G
- Sequence
agttaataattatttattctatat[T/G]tttacataactagaagagaggatt
- ASB in cell types
- foreskin keratinocyte KMS-11 (Plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 2.17 | -0.54 | 2.17 | |||
| KMS-11 (Plasma cell myeloma) | n/a | 1.61 | 4.67 |
Items per page:
1 – 2 of 2