rs12744667 chr1:4008185 G>A
- Sequence
gtgcctgcaaagtggaggtcacat[G/A]actagtacccctcaccttggatca
- ASB for transcription factors
- MITF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MITF_HUMAN | 2.38 | -2.07 | 1.00 | -8.42 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), fasting blood glucose, ldl cholesterol, refractive error, total cholesterol