rs12775296 chr10:19819299 C>G
- Sequence
aaaagaatggttttaaattccttg[C/G]caaattttcgaagacttttataaa
- ASB in cell types
- MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | -2.24 | 2.50 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, birth weight, coronary artery disease (cad), fasting insulin, homa-b, homa-ir, lp-pla2 activity, obesity with early age of onset (age >2)