rs12788257 chr11:31233498 T>C
- Sequence
cttctttggttctctaattacttt[T/C]tgggggtggggaggtacccaaaag
- ASB in cell types
- neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | -0.66 | 1.36 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, chronic kidney disease, hdl cholesterol, ldl cholesterol, ldl cholesterol change with statins, serum creatinine, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Breast_Mammary_Tissue, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Testis