rs12810020 chr12:1720737 T>C
- Sequence
tgaggccaggttcctaacaggcta[T/C]ggaattggcttgtagcctaggggt
- ASB in cell types
- embryonic stem cells derived definitive endoderm
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| embryonic stem cells derived definitive endoderm | 1.81 | n/a | 1.00 |
Items per page:
1 – 1 of 1