rs12817051 chr12:7991685 T>A
- Sequence
ggatttccccatgtctggggcatg[T/A]ttatattcatttctaattgatcca
- ASB in cell types
- ZR-75-1 (invasive ductal carcinoma) HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 2.78 | -0.45 | 1.33 | -4.44 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Testis