rs12822334 chr12:1605625 G>C
- Sequence
gactaatgaggagtgcaccctgcc[G/C]agcagaaggggaagcaggagcggg
- ASB in cell types
- foreskin keratinocyte GM10847 (female B-cells Lymphoblastoid Cell Lines) GM02610 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.54 | n/a | 2.83 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | 1.83 | -0.37 | 1.00 | |||
| GM02610 (Lymphoblastoid Cell Lines) | 1.07 | -0.67 | 1.00 |
Items per page:
1 – 3 of 3