rs128494 chr21:36461960 T>C
- Sequence
agagtaactgctttcctgggaagg[T/C]gggatctgaagggatgacagccgg
- ASB in cell types
- MM1.S (plasma cell myeloma)
- ASB for transcription factors
- IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | -0.04 | 2.67 | 1.75 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI estimated glomerular filtration rate, glomerular filtration rate, hematocrit, hemoglobin concentration, red blood cell count
GRASP arthritis including non-rheumatoid, diastolic blood pressure (dbp), infant head circumference, longstanding arthritis, neuroblastoma (brain cancer), waist hip ratio