rs1288875 chr5:103664092 G>A
- Sequence
gcggccatttcagaggcctccccc[G/A]ggaactcattctctttttcagggc
- ASB in cell types
- WA01 (H1, human embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA01 (H1, human embryonic stem cells) | 1.11 | -0.24 | 1.08 |
Items per page:
1 – 1 of 1