rs1289879 chr1:117358296 G>A
- Sequence
gcaatggcgggcgcccctcctcca[G/A]ccttgctgccgccttgcagtttga
- ASB in cell types
- HEK293 (embryonic kidney) HepG2 (hepatoblastoma)
- ASB for transcription factors
- TYY1_HUMAN ZN577_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TYY1_HUMAN | 1.46 | -0.13 | 1.20 | n/a | No Hit | |||
| ZN577_HUMAN | 3.06 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg