rs12906868 chr15:32152794 A>C
- Sequence
tttgaaaggccagagttgtttact[A/C]tctctccaaggggcctccagagtc
- ASB for transcription factors
- PDX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PDX1_HUMAN | -2.52 | 2.30 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1