rs12916733 chr15:67102046 C>T
- Sequence
tgatatttatttcttccatcaaat[C/T]ggattatgaggcacctgatctgtt
- ASB in cell types
- D283 Med (medulloblastoma) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- OTX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| OTX2_HUMAN | 2.61 | n/a | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), coronary artery disease (cad), fasting blood glucose, infant head circumference, salmonella-induced pyroptosis