rs12927515 chr16:78046244 T>G
- Sequence
acttggacaacataaagggctgat[T/G]gagcggggccactttttcgcccgc
- ASB in cell types
- Ishikawa (endometrial adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Ishikawa (endometrial adenocarcinoma) | 2.48 | -1.34 | 1.00 |
Items per page:
1 – 1 of 1