rs12946374 chr17:27349135 A>G
- Sequence
ccctgtgcccgcgtccccgaggca[A/G]ccgactgcgccgcccccaccctcg
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | 0.88 | -0.47 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.45 | 0.61 | 1.04 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Lung, Nerve_Tibial, Testis, Whole_Blood