rs12948357 chr17:17313773 C>G
- Sequence
aggaactgctgctccccgggaggc[C/G]acgccattgtgctgccatcttgag
- ASB in cell types
- MS-1 (Small cell lung carcinoma) HepG2 (hepatoblastoma) GM10847 (female B-cells Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | n/a | 1.35 | 1.33 | |||
| HepG2 (hepatoblastoma) | 1.02 | 0.29 | 1.18 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | 0.66 | -0.17 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.83 | -1.78 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Lung, Thyroid, Whole_Blood