rs12950541 chr17:80760693 G>A
- Sequence
ttcctgctccagaaaagggaacta[G/A]gattgggctgcagatgacggctgt
- ASB in cell types
- SU-DHL-10 (diffuse large B-cell lymphoma) breast tumor monocyte-derived dendritic cells CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- SPI1_HUMAN MEF2B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.20 | 0.67 | 1.17 | 0.34 | Weak Discordant | |||
| MEF2B_HUMAN | 0.54 | 2.29 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
