rs12978480 chr19:53365563 A>T
- Sequence
tgggagggaggctgagagacgcac[A/T]gatcccgccccagcccagccccgc
- ASB in cell types
- neural cell foreskin keratinocyte 2588 (Lymphoblastoid Cell Lines) GM12891 (male B- cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.96 | -0.26 | 1.43 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Thyroid, Whole_Blood