rs12980205 chr19:43504218 C>T
- Sequence
gcgtctgctccggggcgcggagac[C/T]cccccccaaggaggcggggcctaa
- ASB in cell types
- 22RV1 (prostate carcinoma) breast tumor
- ASB for transcription factors
- ESR1_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.46 | -4.69 | 2.00 | -2.53 | Concordant | |||
| ANDR_HUMAN | 2.27 | 1.16 | 1.67 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), hdl cholesterol, ldl cholesterol, years of education