rs12983007 chr19:3142007 C>A
- Sequence
ccctgcggctgcctggcctggctc[C/A]ccacttccccagcagctgcgtttc
- ASB in cell types
- macrophages form periferal blood MDM(monocyte derived macrophages) CD34+ hematopoietic stem cells
- ASB for transcription factors
- SPI1_HUMAN TIF1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.40 | 1.34 | 1.52 | -0.72 | Weak Concordant | |||
| TIF1B_HUMAN | 2.28 | -1.54 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Esophagus_Mucosa, Minor_Salivary_Gland, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg