rs1298340 chr14:68210775 G>C
- Sequence
gcaaaagcaaggaaatgcgcttgt[G/C]atcagtatcatgttgacgtggagt
- ASB in cell types
- TTC-1240 (Rhabdoid tumor of the kidney) CD14+ monocytes HUVEC-C (HUVEC, umbilical vein endothelial cells) GM12890 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAT1_HUMAN TF65_HUMAN SMRC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.88 | n/a | 2.00 | n/a | No Hit | |||
| TF65_HUMAN | 1.86 | n/a | 3.00 | n/a | No Hit | |||
| SMRC1_HUMAN | -0.33 | 1.83 | 1.50 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, atrial fibrillation, breast cancer (male breast cancer), college completion, diastolic blood pressure (dbp), hdl cholesterol, height, serum creatinine, systolic blood pressure (sbp), transmission distortion, waist hip ratio, years of education