rs13010690 chr2:216777704 C>T
- Sequence
ggcgatggggagaatttggtgagg[C/T]tagaggtgaggccattgcagttat
- ASB in cell types
- PC9 (lung adenocarcinoma)
- ASB for transcription factors
- FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXK2_HUMAN | 2.44 | -2.02 | 1.50 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, aortic valve calcium, obesity with early age of onset (age >2), refractive error, sporadic creutzfeldt-jakob disease