rs13013758 chr2:148162925 G>A
- Sequence
aaactaatattcagagaacttaat[G/A]taccaaataaactaataaaatact
- ASB in cell types
- LHSAR (prostate epithelial cells) 22RV1 (prostate carcinoma) adult erythroblasts
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 1.73 | -0.72 | 1.86 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, hdl cholesterol change with statins, ldl cholesterol, parkinsons disease, serum creatinine, total cholesterol, total cholesterol change with statins, triglycerides, triglycerides change with statins, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood