rs13024296 chr2:223725779 G>A
- Sequence
gtcaaagcctccctttctttcaga[G/A]gagtaggaagagaatggcaatggc
- ASB in cell types
- HAEC (human aortic endothelial cells) breast tumor neural progenitors
- ASB for transcription factors
- JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 2.32 | 0.25 | 1.30 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), cystatin c in serum, transmission distortion